sigW [2019-08-30 16:18:49]

[SW|RNA polymerase] ECF-type [SW|sigma factor] SigW, required for the adaptation to membrane active agents, activated by alkaline shock and by polymyxin B, vancomycin, cephalosporin C, D-cycloserine, and triton X-100

locus: BSU_01730

pI: 8.61

mw: 21.57 kDa

protein length: 187 aa

gene length: 564 bp

function: adaptation to membrane-active compounds

product: [SW|RNA polymerase] ECF-type [SW|sigma factor] SigW

essential: no

synonyms: ybbL

Genomic Context

categories

• [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.1|Transcription] → [category|SW 3.2.1.2|Sigma factors]
• [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.1|Sigma factors]
• [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]

Gene

Coordinates: 194,849 195,412

Phenotypes of a mutant

• sensitive to -lactam antibiotics such as cefuroxime and to fosfomycin [Pubmed|22178969]
• Inactivation of ''[gene|8BA7714236EBFDBB9987F1DACC9775AD974C743E|alsR]'', ''[gene|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]'' and ''[gene|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]'' increases competitive fitness of ''Bacillus subtilis'' under non-sporulating conditions [Pubmed|22344650]

The protein

Protein family

• [SW|Sigma-70 factor family] (according to UniProt)
• [SW|ECF subfamily] (according to UniProt)

Effectors of protein activity

• [protein|4E720917045032E8B45CB8AF6E5C13AE0E48EE33|RsiW] acts as antagonist of SigW (anti-SigW)

Structure

• [PDB|5WUQ] (complex with the cytoplasmic domain of [protein|4E720917045032E8B45CB8AF6E5C13AE0E48EE33|RsiW]) [pubmed|28319136]

Expression and Regulation

Operons

• genes: [gene|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]-[gene|4E720917045032E8B45CB8AF6E5C13AE0E48EE33|rsiW]
  description: [Pubmed|12207695]

  sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|12207695], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]

  regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|12076816], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]

  regulation

  • induced under conditions of alkali shock or in the presence of the toxin [protein|search|SdpC] ([protein|search|SigW]) [Pubmed|12207695]

  additional information

  • the mRNA is very stable (half-life > 15 min) [http://www.ncbi.nlm.nih.gov/sites/entrez/12884008 PubMed]

Biological materials

Mutant

• 1A905 ( ''sigW''::''erm''), [Pubmed|11244082], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A905&Search=1A905 BGSC]
• BKE01730 ([gene|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTATCTAACCTCTGC, downstream forward: _UP4_AGGGATCTTTAAGTGGGGTG
• BKK01730 ([gene|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTATCTAACCTCTGC, downstream forward: _UP4_AGGGATCTTTAAGTGGGGTG

labs

• [SW|John Helmann], Cornell University, USA [http://www.micro.cornell.edu/research/labs/helmann-lab/index.cfm Homepage]
• [SW|Thomas Wiegert], University of Bayreuth, Germany [http://www.genetik.uni-bayreuth.de/LSGenetik1/Thomas Wiegert-Dateien/Thomas Wiegert.html Homepage]

References

Reviews

• 22381678,24921931,26901131,27344142,29343670

The [SW|SigW regulon]

• 9683469,16629676,17675383,11866510,9987136,10960106,23934352,23155385

Other original publications

• 11222589,14993308,16816000,17338440,12207695,11454200,14563871,12076816,19820159,21821766,22344650,14993308,23185515,20817771,21542858,22178969,27137497,27977677,28319136,29454936